Please use this identifier to cite or link to this item: http://hdl.handle.net/2440/7103
Citations
Scopus Web of ScienceĀ® Altmetric
?
?
Type: Journal article
Title: Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat
Author: Yu, S.
Mangelsdorf, M.
Hewett, D.
Hobson, L.
Baker, E.
Eyre, H.
Lapsys, N.
Le Paslier, D.
Doggett, N.
Sutherland, G.
Richards, R.
Citation: Cell, 1997; 88(3):367-374
Publisher: CELL PRESS
Issue Date: 1997
ISSN: 0092-8674
1097-4172
Statement of
Responsibility: 
Yu, Sui; Mangelsdorf, Marie; Hewett, Duncan; Hobson, Lynne; Baker, Elizabeth; Eyre, Helen J; Lapsys, Naras; Le Paslier, Denis; Doggett, Norman A; Sutherland, Grant R; Richards, Robert I
Abstract: Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Keywords: Chromosomes, Human, Pair 16; Humans; Chromosome Fragility; DNA, Satellite; Blotting, Southern; Cloning, Molecular; Polymerase Chain Reaction; Gene Amplification; Base Composition; Base Sequence; Minisatellite Repeats; Polymorphism, Genetic; Chromosome Fragile Sites; Molecular Sequence Data
RMID: 0030005702
DOI: 10.1016/S0092-8674(00)81875-9
Appears in Collections:Paediatrics publications

Files in This Item:
There are no files associated with this item.


Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.